CSI im Chemie-Unterricht

Unser System kann auch fächerübergreifend in Chemiekursen eingesetzt werden, um das fächerübergreifende, kontextbezogene Lernen und Denken der Schüler/innen zu fördern. Denn bezüglich des Chemieunterrichts bietet das CSI-System wundervolle Lernkontexte, wie etwa…

  • Polymerchemie von natürlichen Polymeren (Agarose, DNA, Proteine wie Polymerase)
  • Basiskonzept Säure-Base-Chemie (Puffer, DNA als Säure, Wanderung von Säurerest-Anionen im elektrischen Feld, Basen der Nukleotide, Ampholyte wie Cholin, Protolysestufen von Phosphorsäure, Hydrogenphosphaten, Phosphat)
  • Trennmethoden
  • Aufbau diverser Naturstoffe wie z.B. (Phospho-)Lipide als Mehrfachester des Propan-1,2,3-triols mit Carbonsäuren und Phosphorsäure, DNA als Polyester,…
  • Farbstoff-Chemie (Fluoreszenz-Marker)
  • zwischenmolekulare Wechselwirkungen/ Struktur-Teilchen-Prinzip und Schmelzen bzw. Sieden von Teilchen
  • Kunststoffchemie (Materialien der Pipetten, Pipettenspitzen, Elektrophoresekammern)
  • Reaktionsmechanismen wie enzymatisch katalysierte Veresterung
  • usw…

 

Mögliche fachliche Fragen, die nach der CSI-Einheit im Chemieunterricht beantwortet werden können, sind:

 

1. Vergleichen Sie den Aufbau von Phospholipiden und DNA bezüglich folgender Aspekte:

  • Vergleich der Baueinheiten und Bindungen.
  • Vergleichende Erläuterung, ob es sich bei genannten Stoffen weshalb um Polymere handelt oder weshalb nicht.

 

2. In der ersten Arbeitsphase A des CSI-Projekts wurden Biomembrane zerstört. Dazu verwendete man das Tensid-artige SDS sowie hohe Temperaturen (2 min bei 95°C). Erläutern Sie dies.

 

3. Bei der PCR spielen Temperaturänderungen eine wichtige Rolle.

a. Nennen Sie je ein Argument dafür, dass das sogenannte „Aufschmelzen von DNA“ eher

  • dem Schmelz-Prozess
  • dem Siede-Prozess

b. Stellen Sie kurz die Abläufe der drei Phasen eines PCR-Zyklus dar und erläutern Sie, weshalb die Temperatur der Annealing- (Anlagerungs-, oder Hybridisierungs-)Phase unterhalb der Temperatur der Denaturierungs-Phase liegt.

c. Es ist möglich, die Abläufe einer standardisierten PCR (wie etwa beim genetischen Fingerabdruck) weiter zu optimieren, indem man z.B. die Temperaturen der Denaturierungs-Phase und der Annealing-Phase an die DNA-Probe und Primer anpasst. Die zur Denaturierung von DNA benötigte Temperatur und zur Anlagerung der Primer optimale Temperatur werden durch den GC-Anteil von DNA bzw. Primer bestimmt.

 

4. Erläutern Sie kurz (unter Rückbezug zu Ihren Ausführungen zu Aufgabe 1) die im Materialteil M4 dargestellte Chargaff-Regel.

 

5. Begründen Sie kurz, ob eine DNA-Doppelhelix mit einem höheren oder niedrigeren GC-Gehalt eine höhere oder niedrigere Schmelztemperatur hat.

 

6. Als interner Standard für die Methode der Real-time-PCR wird oft das „L27-Gen“ verwendet.

[1] Das L27-Gen ist hochkonservative und hat sich zeit Jahrtausenden nicht verändert (ist also Mutations-frei geblieben und damit bei nahezu allen Organismen). Das L27-Gen codiert für eine Tertiärstruktur des Ribosom-Protein-Komplexes (für die 60S-Untereinheit).

Um dieses Gen mithilfe der PCR zu vervielfältigen, nutzt man die beiden folgenden Primer:

Forward-Primer AAAGCCGTCATCGTGAAGAAC

Reverse-Primer GCTGTCACTTTCCGGGGATAG

Berechnen Sie die Schmelztemperatur für den Forward-Primer.

 

7. Produktschutz: Arbeiten mit Handschuhen.

Geben Sie eine begründete Hypothese an, welche Stoffe an der Hand welche Stoffe im Reaktionsgemisch des genetischen Fingerabdrucks weshalb schädigen könnten.

 

8. Definieren Sie kurz die Begriffe Aldose, Ketose, Furanose (Materialteil) und Pentose und ordnen Sie jedem der vier Begriffe ein entsprechendes Beispiel aus dem Materialteil zu. (Sie haben freie Wahl, welches Beispielmolekül aus dem Material sie zuordnen.)

 

9. Fischer-Projektion

a. Nennen Sie die Regeln der Fischer-Projektion und definieren Sie den Begriff „asymmetrisches C-Atom“ an einem Molekül-Beispiel Ihrer Wahl aus dem Materialteil.

b. Leiten Sie her, ob das im Materialteil dargestellte Milchsäure-Molekül in D- und L-Form vorliegt. Listen Sie Ihr Vorgehen bzw. Ihre Denkschritte stichwortartig auf.

(Sie können die Modellbaukästen verwenden.)

 

10. Prüfen Sie, welche der in M7 dargestellten Moleküle…

  • …NICHT in Fischer-Projektion vorliegen und
  • …KEIN asymmetrisches C-Atome besitzen.

Und begründen Sie, weshalb diese Teilchen…

  • …nicht in Fischer-Projektion vorliegen und
  • …kein einziges asymmetrisches C-Atom aufweisen.

 

11. Haworth-Projektion

a. Erläutern Sie, wie man aus einer offenkettigen L-Ribulose die ringförmige alpha-L-Ribulofuranose (Ribulose als Furanose) herleitet. Erläutern Sie so als würden Sie eine Bedienungsanleitung anfertigen. Skizzieren Sie alpha-L-Ribulofuranose.

(Sie können die Modellbaukästen verwenden.)

b. Überführen Sie beta-D-Doppeldesoxyribofuranose (M6) in ihre offenkettige Fischer-Projektion. Erläutern Sie auch hier Ihr Vorgehen, so als würden Sie eine Bedienungsanleitung anfertigen. Skizzieren Sie die D-Doppeldesoxyribose.

(Sie können die Modellbaukästen verwenden.)

 

12. Nehmen Sie Stellung zu folgenden Aussagen rund um die DNA:

  • „Ein DNA-Einzelstrang lässt sich besser als RNA in Wasser lösen.“
  • „Eine Nukleotid-Synthese mit Doppel-Desoxyribose möglich wäre, nicht aber die Synthese eines DNA-Einzelstrangs.“

 

13. Vergleichen (Gemeinsamkeiten und Unterschiede geordnet darstellen) Sie den Aufbau von einem Protein wie die Taq-Polymerase und von der DNA bzgl. folgender Kategorien:

Monomere und Bindungen, räumliche Strukturen, und zwei Kategorien Ihrer Wahl.

 

14. Bei der PCR werden bei der Denaturierungsphase durch Hitze die antiparallelen komplementären DNA-Einzelstränge voneinander getrennt. Durch Abkühlen lagern sich dann eher komplementäre antiparallele Primer an die entsprechenden DNA-Sequenzen, als dass sich die frisch getrennten DNA-Einzelstränge wieder aneinanderlagern. Erklären Sie diesen Sachverhalt.

 


Sämtliche Arbeitsmaterialien wurden zusammen mit Schülerinnen und Schülern im Biologieunterricht entwickelt, stets weiterentwickelt, wurden an den Chemieunterricht angepasst und werden derzeit in Unterrichtsreihen des Chemieunterrichts erprobt und weiterentwickelt.